Wöööh

Påväg till Södertälje nu med the famous Blogger Sarah Carlsten hahaha, vad gör ni? Puss !

tjuz

Är hemma hos Sarah nu, vi var på grönan ett tag och har nyss ätit middag. Men ska snart ut igen, hade lite kul mde Sarahs webb också så så här ser jag ut just nu :) vad tycks? pussiii





....

Another day, without your smile, another day just passes by, but now I know, how much it means, for you stay, right here with me..


31 maj 2011

Godmorgon! Vaknade halv 1?! Blev förvånad av mig själv.. men behövde väl verkligen sova ut antar jag :) Lite tråkigare att jag egentligen skulle ut nu så sitter jag här nyvaken istället. Men det är skönt att jag är själv hemma iaf :) så sitter och lyssnar på hög musik, ska duscha och fixa till mig. Såååå vi hörs snart igen! Och fortsätt kommentera om klänningarna i inlägget under, blir jätte glad! Puss

Någon random bild jag tog igår.


Ångeeeeest!

Jag har verkligen suttit och letat som en galning efter en balklänning men jag hittar verkligen ingen speciell som jag vill ha!! Och jag måste ju typ beställa en senast imorgon för att vara säker på att jag får den i tid lixom..  börjar kännas ganska så stressigt nu.. så bestämde mig för någon enkel. Vill ha vit, eller rosa kanske..? Aja vilken av dom här är snyggast tycker ni? vilken skulle jag passa bäst i? Behöver eran hjälp, kan inte bestämma mig. Snäälla!



(klicka på bilderna för att se dom i större format)

Är förövrigt kär i den här, men kan man verkligen ha den på balen? Help me!


I always need a time on my own

Hej på er! Det har varit en sån jävla chill dag idag asså. Jag och Sarah har fått semester redan, lediga tills nästa tisdag och då har vi bara klassens dag, bal & avslutning då är det sommarlov!!!!!! galet sjukt att tiden gått så snabbt hähä. För vi har tema dagar till onsdag o pallar inte de & lediga torsdag och fredag tills tisdag. Så ja huuur najs? Lite avundsjuka borde ni faktiskt vara ;)Hörs snart, pusspuss :D


I brist på annat

Orkar inte blogga idag, ha-ha.. märks det?

Under 2011 har jag hittills:

[x] du har fått nya kompisar
[ ] du har varit utomlands
[x] du har varit ledsen
[x] du har velat dö
[x] du har varit glad
[x] du har druckit alkohol
[/] du har blivit kär
[x] du har känt dig sviken
[ ] du har känt som att ingen har sett dig
[x] du har suttit vid datorn mer än innan
[x] du har skrivit en låt 
[x] du har känt hat
[x] du har varit "sjuk"
[x] du har varit sjuk
[x] du har dansat
[x] du har bråkat med dina föräldrar
[x] du har bråkat med din älskling/kompis
[x] du har strulat med en främling
[x] du har strulat med en av samma kön
[x] du har varit så uppjagad att du gjort misstag
[x] du har gråtit för något som hänt i ditt liv
[x] du har kallat någon hora/slampa
[x] du har pissat utomhus
[ ] du har slagit någon
[x] du har spytt
[ ] du har knarkat
[x] du har sovit i motsatta könets säng
[x] du har raggat på främlingar
[x] du har kysst en främling
[x] du har rökt 
[x] du har rymt hemifrån
[x] du har bakat
[ ] du har sovit utomhus (tält haha )
[ ] du har åkt bil med fyllon
[x] du har varit full
[/] du har varit/är kär
[x] du har saknat någon 
[ ] du har badat i havet
[x] du har solat utomhus
[x] du har solat i solarium
[x] du har snackat i telefon mer än 2 timmar
[ ] du har gett någon blommor
[ ] du har sett en död människa

Jag har väl gjort det mesta så att säga.. :D

Från top notch


yeeei!

Najs kväll

Kom nyss hem, mötte bea i huddinge sen kom Hanna avin och massa till. Vi chillade lite dääära sen drog vi till stuvsta ip och chillade äääännu mer. Haha, får alltid ångest när jag "kommer hem sent" på söndagar när man ska vakna upp tidigt och gå till skolan, hemskt. Har inte ätit middag heller så det känns som jag kommer spy vilken sekund som helst, så ska käka nu. Pussi



ganska söta

tjohej

Berättar om gårdagen och allting ikväll när jag kommit hem!! Hur grymt som helst :) Nu ska jag till huddinge och möta världens bästa beatrice. Puss


28 maj 2011

Godmorgon :) Sovit gott? Jag har sovit helt okej. Förlåt för inlägget nedanför men så kan det gå ibland.... vaknade nyss i alla fall. Jag och Sarah skulle egentligen dra in till tumba runt nio tiden för en sak men båda försov sig så antar att det får bli senare. Ska fixa till mig lite & käka någonting så vi hörs!


kvällstankar

Sitter här, kan inte sova. Ska upp om 5 timmar, jag är trött men endå går det inte att lägga sig och bara somna. Så mycket i mitt huvud just nu, så mycket som händer. Vet inte vad jag ska göra. Känns som om typ allting förändras. Snart ska jag sluta grundskolan, hela 10 år har jag gått där, snart börjar jag gymnasiumet, nya människor, ny miljö nytt allt. Känns så sorligt men samtidigt skönt, och kanske bra. Snart flyttar jag också. Vet inte riktigt hur jag ska hantera allting på samma gång, vet absolut ingenting, inte ens vad jag skriver om nu.

Jag har varit ledsen hela dagen, inte pga något jag har skrivit utan för en annan sak. Vill så gärna ta upp det här i bloggen, men kan inte, vill men samtidigt inte. Jag smsar dig gång på gång, får inte något svar... inte nu iaf. vet inte vad jag ska göra om jag förlorar dig, aldrig har jag känt såhär förut. På det sättet jag gör nu, för en person. Jag är så korkad, varför är jag så jävla dum? alltid jag som ska göra fel med allting, alltid jag som tänker fel och tro att saker ska bli bättre fast dom bara bli sämre.

hur kan jag vara så dum att tänka som jag gjorde? Ni förstår säkert ingenting vad jag skriver om, men jag måste få skriva av mig. Och bloggen är ju som en dagbok fast öppen för alla, visst är det inte så? det är ju som sagt min egna blogg där jag skriver vad jag vill i, och nu var det längesen jag skrev om det jag känner. Har inte velat göra det i bloggen och ta ut det över er och att ni tror att jag är värsta emot som sitter hemma och skär mig om dagarna, bara för den här deprimerade texten. Absolut inte, jag är bara ledsen och då blir jag bara extra känslig för allting, tårarna vill bara forsa ut just nu, men jag tänker inte gråta. Sån är inte jag, hoppas på det bästa istället. Fan, jag är så jävla dum.

Ska försöka sova nu, oavsett om det går eller inte. Ska lägga mig och bara koppla bort allting för en stund, och hoppas att det är bättre imorgon.. Sov gott.. Ni är bäst!

Hm..?

2 bilder på mig & mitt nya hår, vad tycker ni?

ändrat kontrasten där, inte lika mörkt i verkligheten..

deppig tjej..

Kom hem runt 12 men har inte orkat blogga sen dess, är inte på världens bästa humör.. vart ganska deppig hela kvällen faktiskt, mycket tankar i huvudet och så och ja... vi ska inte gå in på de menmen :/

Sålde lite biljetter idag runt fem sen drog jag och sarah till grönan mötte upp hugo, william, sandra, emma osv. Var najs. Sen hämtade danne oss och vi åkte förbi ett ställe sen drog vi hem, helt slut & ska upp tidigt imorgon. Färgade ju håret idag också, har tänkt på att jag aldrig blir nöjd med mitt hår, aldrig.. nu vill jag ha ljusare igen. Skulle bli ljusbrunt men självklart blir det mer åt det mörka hållet, blöööö. haha känner att jag ska sluta klaga, yeye ni får bild snart :)


Haha nej jag åt inte maten själv..

Och en random bild från igår jag kände för att lägga in, rip ljusa hår </3

Färgar håret...

Just nu; sitter och färgar håret... Läskigt :) ni får bild sen, puss!

It's friday

Klarfixad! Men fixade mig inte så mycket ska ju in till stan och göra en sak nu....... spännande.. hinner verkligen inte lägga upp dagens outfit för har ganska bråttom, får fixa allt det där sen. Men jag mobilbloggar under dagen, i promise! Puss!!

Låten suger fett enligt mig hahaha.. men.. its friday! ;)


27e maj 2011

Godmorgon förresten! Vaknade tio idag, ni kanske vill veta varför? Jo för våran skola har studiedag så vi är lediga, helt underbart haha! ;) Ska äta en nyttig frukost nu sen fixa till mig, ser ut som jag vet inte vad haha.. bloggar mer snart puss!

Moi & ebba


Skvallerblogg

Ännu en skvallerblogg som jag är med i. Haha dom kan verkligen aldrig få nog.. ;) Check it out?

http://gossipfun.blogg.se


Svar på tal

Snälla! Kan du visa hur du fixar ditt hår? Skulle bli sjukt tacksam om du gjorde det! <3

Svar: Asså vad är grejen med att jag får typ tre såna här kommentarer per dag? "visa hur du fixar ditt hår blabla.." haha börjar bli lite tjatigt nu :) Jag borstar det bara, plattar det och sätter i mitt löshår, och IBLAND kanske jag sprayar dit lite hårspray för mer volym. Inte speciellt komplicerat :P


Själv hatar jag mitt hår och dom som känner mig vet hur ofta jag klagar på det, ni skulle bara veta haha ;)

Vad väntar ni på? ;)

Några här som vill festa galet med 3000 pers på lördag!? KLART NI VILL! Biljetterna tar slut väldigt snabbt & kommer lämnas in imorgon. Så på eftermiddagen eller förmiddagen imorgon i centralen vore perfekt! Tänk på att om ni väljer att köpa i dörren när ni kommer dit blir det ännu dyrare så passa på att ta dom sista!!
SISTA DAGEN IMORGON ATT KÖPA BILJETTER! SÄKRA DIN BILJETT REDAN NU!!! smsa 0736368165 (mitt nummer) för biljetter sötnosar!

Plats: Solna Hallen, Stockholm
Datum: 28 Maj
Tid: 20.00 - 02.00
...Pris: 150 kr
Ålder: 15-20 år (Födda år 96)
○ 3000 pers, Ett stort Dansgolv!
○ Grymma DJ's!
○ Alkohol & Drogfritt

Intresserade? 0736368165!!


borta bra, hemma bäst = sant

Kom nyss hem.. trött som f*n! Så ska lägga mig i sängen kolla facebook och lite så.. alldeles för trött för att blogga & min hjärna orkar inte tänka just nu så har inga ideer heller, bajs sorry. Imorgon händer det grejer så stay tuned ;) Puss


Någon dag sen jao

Mobilbloggar

Just nu är jag och sarah på grönan och steker.. Kom hit runt sju därför jag inte uppdateraT. Men nu ska vi popexpressen wie ;) hörs senare!

suprise

Jag sitter i min säng, hör någonting knacka på mitt fönster, tror det är en inbrottstjuv, och de värsta av allt så va fönstret öppet - så hon öppnar det och säger HEEEEEEEJ. Fick panik, vem kan de va? Jo Sarah carlsten. Sanningen bakom den hon är egentligen är :) Och det första hon säger ''får jag låna din tröja?''
Asså... hahaha!


Säg hej till Sarah Carlsten

En tankeställare

I helgen färgar jag nog tillbaka till mitt mörka hår.. fast nog inte så mörkt jag hade då utan lite mer "brunare" är inte riktigt säker än men 90 % säker på att jag faktiskt vill. Kommer ju kännas tråkigt att inte va ljushårig på ett sätt, men samtidigt tycker jag själv att jag är mycketmycketmycket snyggare i mööörkt faktiskt, gaah vad jag saknar det när jag ser bilder!

Vad tycker ni? =)



*puh*

Hemma nu..

Det så bra att jag kan uppdatera med mobilen då & då. Det känns lixom lättare att kunna uppdatera när som ;) Min klass vann hela fotbollstuneringen, så grymma!! Grattis till oss :D Förutom det så är jag helt slut nu så ska vara hemma och bara ta det lugnt ett tag tills jag ska ut igen!

Lite bilder :)


Melina och jag


Vinst!


Karl & viktor


Underbara personer :)

Äter


Hej på er! Sitter nu i skogås med några och äter men ska snart tillbaka och se finalen. Vad gör ni? Puss

Torsdag morgon

Godmorgon Babys! Är nu på mossen och kollar när min klass spelar mot 9a.. Riktigt spännande faktiskt hehe, uppdaterar mer sen puss ;)

Riktigt trött chey

Har faktiskt kännt mig riktigt duktig idag! Har gjort jätte många uppgifter klar gjorda i sista sekunden och nu skickade jag in min no till min lärare så att jag inte får IG, underbart! Haha sorry att jag snackar så mycket om skolan och plugg just nu känns det som men snart blir det roligare uppdateringar :D

Nu ska vi lägga oss, mina ögon håller på att slockna när som helst, så himla trött. Idag var det också våran sista riktiga lektion, så imorgon ska vi till mossen och ha fotbollstunering... haha nää vill inte ens tänka på det, fyfan vad tråkigt. Idrott är mitt hat ämne i skolan som några av er säkert redan visste, i hate it..

Godnatt och sovgott!


yes

Kom hem för ett tag sen, jag och Sarah har ätit nudlar och nu ska vi kolla på fucking åmål. Puss


Update

Tja fan :) bloggar nu direkt från bilen jao, är med andrew, sarah, mathias och daniel. Vi har vart i länna och lite sånt, i trångsund med några också. Men nu ska vi hem så bloggar mer snart ;) förresten det går inte att ladda upp bilder ? Bajstråkigt.. Puss

Hos sarah

Hej baby's! Hade tänkt testa mobilblogg och se om det funkar bra med det, ska jag börja göra det oftare? Puss ;)

alla som har mitt nummer, kan inte svara

Hejhej..

Jag är lite sådär smågrinig just nu för jag har inte haft en mobil igår kväll & nu när man äntligen kom hem och skulle ladda den så har mobilladdaren gått sönder, kan ni fatta känslan ? INTE PÅ EN HEL JÄVLA DAG. åååh :@

Jaja ska i alla fall åka in till stan nu för att möta upp min mamma och få pengar till behövliga saker,efter det får jag se vad som händer, kan ju inte nå någon just nu så vet inte hur jag hade tänkt med det här. Ikväll har jag i alla fall en mobil igen.. hoppas jag, så ni som har mitt nummer och läser det här och smsar, nu vet ni varför jag inte kommer kunna svara inom någon timme, bajskorv också! Oj.. .Måste rusa till tåget nu, kommer aldrig hinna.. tjarå!


@ trångsundsskolan

Sitter nu i skolan och skriver galet på slöjduppgiften som sätts betyg på idag! Och sen min no uppgift som måste in ikväll annars blir det IG.. så stressigt i skolan nu så det finns inte! Men ska bli skönt när allting är över :) Vad gör ni själva? Har ni också det lika jobbigt som jag ?

Måste fortsätta, puss


Är det verkligen jag på bilden? haha


woop woooop

Ny design.. äntligen! som ni och även jag väntat riktigt länge på, varit lite segt på den fronten. Hade ju även mörkt hår på min andrah header ´vilket inte passar in =) Tack sarah du är bäst bästis!!!

Annars då? Kom nyss in. Jag sarah och ludde va ute och strosade lite.. haha nää men var vid vattnet och lite sånt där, skönt men kallt! Ska kolla facebook lite nu, duscha sen ska vi somna till en film :) kanske slänger in ett inlägg innan dess annars hörs vi imorgon.

sov så gott!


En bild på mig Jackie, sarah & rosanna

softish

Hello bitches :) sitter nu hemma hos Sarah och So provet gick väl bra, gick jätte snabbt och smidigt! hähä. Aja nu hade vi hade tänkt plugga och verkligen göra det den här gången....


Kill me, i'm just saying

Ååååååååh har så jävla mycket i skolan just nu, idag måste jag bli klar med bilden, slöjden, svenskan & non och skicka in senast ikväll. Sen har jag idrott & so prov idag... vet inte hur jag ska klara det här :( Blir nog inge mer bloggning förrens ikväll eller något... förlåt men hoppas ni förstår?Ska tillbaka till skolan nu och hämta alla uppgifter och göra mina 2 prov. Puss


Dagens outfit

Lite kallt men aja.. Puss!

Facelook

Bilden tagen nyss faktiskt.. ser jag trött ut? ;) Det kan man i alla fall säga att jag är. Ääeh.. nu ska sminket bort! underbart skönt - puss


Visade bhn lite mycket heh....

<3

Det har varit en mysig dag med klassen idag! Soligt väder och sådära :) Efter vi hade varit i waxholm så drog jag och Sarah till grönan ett tag, träffade Emma, eden carla osv och var där med dom.. trevligt. Runt nio tiden hämtade Danne oss och nu sitter jag här & ska snart tvätta bort mitt smink. Orkar inte berätta detaljerat är för trött för det så ni får bilder istället :) puss!







Selena gomez

Hon har allt. Utseendet, rösten, you name it! Bjuder på en låt med henne jag tycker är bra :) Vad tycker ni?

A day without you is like a year without rain


Grattis!

Vinnaren av veckans blogg blev........ Solin! Grattis tjejen! Hoppas du blev glad :) Och till er andra - det kommer fler chanser ;) Puss!

http://mjws.blogg.se/



Idag ska jag visa vilken kämpare jag är

Godmorgon solstrålar! Idag ska min klass samlas vid tåget typ tio i nio för vi ska iväg på någon fångaren på fortet grej i waxholm och sen efter det äta på någon god resturang, typ våran ''klassresa'' tråkigt att vi inte åker iväg någonstans sista året lixom :( Men det blir säkert kul i alla fall! Nu ska jag klä på mig sen äta lite frukost. Vinnaren av veckans blogg kommer också upp runt två som tidsinställt, spännande ;) vi hörs, puss!


Behövande

Känns som jag inte fått mycket sömn den här helgen kan jag säga.. så nu ska jag tvätta bort mitt smink, smsa lite & lyssna på lite musik tills jag somnar.. kan faktiskt inte bli bättre just nu..! Så ni får sova så gott så hörs vi imorgon, puss ♥


Oups

..För den usla uppdateringen idag, men har inte haft tid! Runt sex tiden åkte jag och Sarah i alla fall in till stan, sen mötte vi beatrice, matilda m.m och drog till kungsan där rix fm var, mötte massa folk där senare, var trevligt! Men drog hem runt 8-9, det var inte lika roligt som förra året, fattar inte att dom har det på en söndag. Men det var helt okej musik. Har insett nu att Eric Saade bara är alldeles för snygg! Haha.. Sen när jag skulle ta kort med kameran så märker jag ju då självklart att jag har glömt mitt minneskort hemma hos Sarah så det gick ju som det gick, så länge får ni en bild på snyggingen! Puss

Vi lever

Hej på er! Igår var vi på grönan hela dagen, riktigt najs. Efter det åkte vi hem till Joey ett tag där några var, sen förbi Sebastian. Vi kollade på klipp från musikvideoinspelningen, och fan vad grymt det kommer bli!! Sen hämtade Danne oss och vi somnade typ direkt när vi kom hem :) Idag vaknade jag & sarah halv ett. Hehe.. och nu har jag precis duschat och vi ska börja fixa oss sen dra oss in mot stan, ikväll blir det rix fm! Puss


Igår


wie

Hej på er! Kommer inte bli så bra uppdatering idag... är hemma nu, ska fixa mig lite snabbt sen dra in till grönaund! Fan va kul :D Vi kanske ses där? papi köpte nyss guldkortet på internet, taaack! Så ja, ni får ha en bra dag :) puss!


orkante blogga just nu

Kom nyss hem, eller hem och hem. Till sarah! Ska äta något sen gå och lägga oss, verkligen skittrötta :) Måste också tänka lite och snacka, om viktiga saker, som varje kväll typ...... hm.. :/ Hörs när jag vaknat. Godnatt :)


åh, underbar dag!!

Hej! Hur är det med er? Med mig är det verkligen suuuper bra :D Jag och sarah skulle egentligen till studion idag efter skolan, vi åkte dit och va där kanske 10 minuter sen ringde Sebastian oss och frågade om vi ville vara med i en musikvideo, kan dock inte säga vilken men en amerikansk iaf.. skulle vara vid gärdet på 20 minuter!? Hann egentligen inte men vad gör man inte för sin vän? ;) Det var verkligen skitkul! Men har jätte ont i benen nu efter allt hoppande haha..... Sen kom också två bloggläsare fram och hälsade lite, jätte söta var ni :D Och nu är jag hemma och vad som händer ikväll återstå att se, har inga planer än sålänge...

En bild innan inspelningen började...

Tråkigt tidsinställt

Hur många har du varit riktigt riktigt kär i? En...
Vad tycker du om kärlek? Både sorgset och glatt på samma gång..
När kramade du någon sist? 5 minuter sen
Saknar du någon speciell person? Kan man säga
Har du svårt för att bli kär? Ganska
Är du singel? Jappp
När fick du senast en komplimang? Idag :)

HAR DU NÅGONSIN:
Varit medvetslös: Ja
Hånglat med nån riktigt ful: HAHAHAHAHA
Hånglat med fler än 50 pers: Haha nej
Hånglat med fler än 2 pers på en kväll? Kanske deee
Gjort något riktigt dumt? Jo tack
Gjort något du verkligen ångrar? mhmmm
Åkt ambulans? En gång
Gjort nåt olagligt? aa
Fått din mamma att gråta? Yes
Slagit ner någon? Nej :D
Skämts över dina föräldrar? Klart man gör haha
Sagt jag älskar dig och menat det? självklart :)
Tar du droger? Nej
Dricker du? Alla dricker? :)
Vilka kläder sover du i? Trosor och någon stor tröja oftast
Vad hatar du verkligen? Falska människor
Varit kär? mh
Är du ensam nu? Nej är i skolan 
Vill du gifta dig? Senare i livet ja :) 
Vill du ha barn? En tjej & en pojke
SENASTE PERSONEN SOM:
Sov i din säng?
Jag..?
Såg dig gråta? Sarah
Fick dig att gråta? Hemlis
Du delade en dricka med? inte vet jag hahaha
Du gick på bio med? niclas, shiva & victor
Skällde på dig? Min lärare
Sa någonting till dig och vad var det? Hur gick det med betygen?


DE SENASTE 48 TIMMARNA HAR DU:
Gråtit? Nepp
Kramat någon? Yes
Pussat någon? ja :)
Köpt någonting? Ja
Sjungit? arå
Saknat någon? mmmmmh

JAG HAR:
Digitalkamera? aa
Systemkamera? Nej
Telefon på rummet? haha nej
Egen dator? Ja
Könssjukdom? usch nej
Bra kompisar? underbara ♥


Rösta!

http://mjws.blogg.se/

http://ericahanssons.blogg.se

Den som får mest röster vinner på söndag, kör på! Puss


20 maj

Godmorgon! Sitter här och plattar håret trött som ett as, har inte ens börjat sminka mig... stress! Åt en jätte nyttig frukost när jag vakna så nu är jag proppmätt haha. Om en halvtimme ska jag till skolan då äre klassråd som gäller. Idag är det också fredag vilket betyder HEEEEELG! Kan inte bli bättre :) Nu måste jag fortsätta. Later


Ganska heeeeemsk bild......

just chilli'n

Kom nyss hem! Var ute med massa, chillade i stortorpsparken och sådära. Trevligt :) Nu är jag hemma och ska hoppa in i duschen, efter det väljer jag dom som får vara med i veckans blogg :) Här får ni en bild på sarah, ella och jesper. Puss!


Im still alive but im barely breathing

Har vart hemma i stort sett hela dagen sen jag kom hem från skolan, varit duktig pluggat lite och sådära.. tog lite egobilder också ;) Det är ju nästan inga som anmäler sig till veckans blogg, tråkiga ni är...! kom igen nu.. Hehe ska snart ut och träffa några i alla fall! Vad ska ni göra ikväll? Puss!



Just nu

Go!



Vill du bli veckans blogg?
Då gör ni såhär!

* Länka mig i ett inlägg om att du är med
* släng en kommentar så att jag ser! Hehe..

Enkelt! Väljer 2 stycken ikväll som är med och tävlar och den som får mest röster vinner imorgon :) puss!

Någon?

Den kommer från salt, storlek XS och jag säljer den för jag har tröttnat på den helt enkelt :) Inte använd så mycket heller. Hör av er om ni är intresserade! I kommentarsfältet eller min mail marilynsandberg@hotmail.com puss!

200 :-


update just for you

Hej på er! Vi hade en och en halvtimmes rast så jag orkade inte vara i skolan så drog hem så länge haha.. men kvart över måste jag tillbaka till skolan igen för vi har engelska redovisning, suck.. men man får väl hoppas att det går bra! Efter skolan vet jag inte riktigt vad som händer. Såhär ser jag ut just nu i alla fall, dagens finfina outfit.. men jag orkade faktiskt inte ha jeans för vi hade idrott osv ;) hörs sen, puss!




I close my eyes and pray

Videon och texten är så fin! Själv börjar jag nästan gråta..


Hur sminkar jag mig?



Ja, det här är då det smink jag använder ''dagligen'' eller foundation inte så ofta för det gillar jag inte på sommaren, tar lite brun utan sol innan jag går och lägger mig i stället sen bara lite puder och solpuder i hela ansiktet. H&Ms rouge och solpuder helt klart eftersom att dom faktiskt är det bästa! Pudret lite ljusare är isadora, och min foundation är väldigt ''tunn'' blir ingen rand eller fläckar eller så, ögonbrynspenna självklart sen två superbra mascaror, sen böjer jag alltid ögonfransarna! Om det är helg och man ska på fest och så använder jag kajal ögonskugga och sådära, lite mer ''fixat'' kan visa det någon annan gång, men det här är det iaf, hoppas ni blev nöjda. Puss!

(haha märkte nu att mitt hårstrå kom med i bilden, oupsie... sorry!)

Hemma igen

Hello :D kom nyss hem! Har varit med Bea, senja och yonnes. Vi satt i parken i solen och chillade lite och lite sånt. Fint väder idag, det gillar vi ;) Glömde helt kameran idag (som vanligt....) Ska bli bättre på den biten, så ni får en där man inte ser så mycket på.. Puss!

Förresten, tack för alla fina kommentarer! Kanske kan göra ett inlägg lite senare eller imorgon om hur jag sminkar mig och fixar håret osv. Just for you.


Bea och Senjis

Faceloook

Nu åker jag mot huddinge, och såhär ser jag ut just nu :) Pussi


heeeeeeeeelp

Kan någon här förklara varför min spotify helt plötsligt inte funkar alls? Inte ens när jag klickar på spellistor... life goes under </3 På riktigt (lördag) påtal om det, säg att det inte är sant!?!?!? snälla :/


hell yeah

Hej babes! Igår var jag på bio med Niclas, Shiva och Victor. Vi såg fast and furious 5, skitbra! Sen sov jag hos Sarah vi tjockade oss lite och kollade på film , deckade runt tolv slaget. Vaknade 10 minuter innan vi skulle till skolbussen idag så man såg ju ut som man gjorde idag i skolan.......... Nu är jag hemma i alla fall, ska fixa mig lite sen ut och träffa några kompisar, Uppdaterar er innan jag drar. Pusspuss :D

<3


weho

Jag kommer hem, sätter på datan. Det har skett ett mirakel, mitt internet funkar igen efter två veckor. Jag kan blogga som vanligt, ni får bättre uppdatering än någonsin! Snart kommer ett inlägg upp vad jag har haft för mig ;) Puss!

Min dag kortfattat

Statistiken höjs, keep going!

Heh, idag efter skolan åkte jag till niclas där Bea och Iza också var, vi kollade på en skräck film, ''dead silence (?)'' skitäcklig med dockor och skit, uuuh :( Sen drog dom så kom Ludvig och har varit med dom hela kvällen, jätte trevligt :) Sen hämtade Sarah och Daniel mig med bilen och nu är jag hemma och hade tänkt hoppa in i duschen sen plugga lite till provet imorgon. Omprovet haha, känns ju ännu bättre att det är sista chansen imorgon lixom. Aja ska sluta babbla, hörs med mer uppdatering imorgon! Pussssss


Jag och sarah på the wave jao

Igårkväll

igår var en jävligt seg dag kan jag säga! Inte hann jag blogga heller... jag och sarah sov till halv tre, sen gjorde vi ingenting speciellt, jag åkte hem och pluggade sen mötte jag Andrew för att fixa en sak. Sen hämtade danne oss så hämta vi sarah, ja ni ser ju bara hur jag ser ut. Hemskt!


I bilen igår, sliten tjej

weho


Jag och Sarah just nu i skolan, har svenska och lämnade in min skrivuppgift i tid, inte ofta det händer :) puss!

Dagens


Ellinore, jag och Julia

Dagens humör: Inte speciellt bra
Dagens frisyr: Bulle
Dagens klädsel: Shors
Dagens borde: sova
Dagens vill ha: godis
Dagens planer: åka in till stan
Dagens längtan: Sommarlooov <3
Dagens beroende: Sängen & mobilen
Dagens tråkigaste: huvudvärk
Dagens irritation: min mamma, och att min väska är helt blöt
Dagens händelse: vet inte
Dagens onyttiga: sockerkaka hahaha
Dagens bästa: ett sms

gaaalen kväll

Igår var det fest hos sebbe, först mötte jag bea, amanda, nettis och sara i huddinge. När vi kom dit var det massa sköna människor man kände / kände igen så de va naaaajs, dansade osv. Mer detaljer kanske vi inte ska gå in på haha..... sov hos Sarah sen och nu håller vi på och fixar oss och ska snart in till stan för att käka på donken, ett måste just nu känner jag... men först bjuder jag på några bilder från igår. ---> Pusshej

'
Jag, Henke och Max


Jag och Ebba


Ellinore, Bea, jag och Julia


Mathias och Julia

Mer bilder på facebook, ba att adda mig där babes.


Rolling in the deep ♥


Älskar låten..!


Everything happends for a reason

Jag är så jävla lycklig, allt känns så jävla bra just nu. Live, love, laugh ♥¨


Haha vad förrvirrande med en bild innan med ljust hår och nu ett mörkt... ;)


weho

Alldeles strax ska jag och sarah ta tåget in till stan för att åka in till studion, ska sjunga ''price tag'' av Jessie J idag ;) Kände att det är tråkigt att hålla det hemligt varje gång :D har väldigt många låtar som inte är klara, dags att lägga ut en cover snart kanske! Efter studion ska jag och Sarah till söder och möta Daniel för lite things. Sen ikväll blir det andra bullar, taggtagggtaggtaggggg! Later.


Gammal bild


yeah

Sitter i skolan nu! Har precis haft nationellt muntligt prov i matte, det kändes faktiskt bättre än det skriftliga, skönt!! Ska ha musik om tio minuter och har gjort lite tidsinställda inlägg till er just so you know, ganska många. Och alla kommer upp idag är det, har verkligen ingen tid alls fördatan idag/ikväll ;) Puss


coolt

Hej bloggen, mitt internet på min data funkar fortfarande inte.. weird (?) så kör en liten snabb uppdatering från pappas data lixooooooom. har vart i huddinge hela dagen med bea, niclas & hampus, vi solade och satt på donken weeeeei. Och nu är jag hemma tog nyss en dusch de va underbart skönt! och nu skare ätas sen sovas. Hörs imorgon pussssssss


torsdag

Tjabba, sitter nu i skolan och försöker jobba på min no om rymden som inte går så bra men jag försöker lixom, efter det här är det spanska och idrott. KUUUUL! och när ja slutat ska jag in till stan och möta mami för lite cash snabbt. Sen annat. Pusssss


Godnatt!

Sover hos Sarah ikväll, och igår sov hon hos mig. Ovanligt att vi sover hos varandra? Väldigt ovanligt.. ;) Men först - tvätta bort sminket och smsa med världens sötaste ♥ Puss


vädret i trångsund/stockholm , hejdå.......

ÄR DET HÄR ETT SKÄMT? Vad fan hände med sommaren.... sur :@


3 bilder


Jag, Rosanna och Sarah. Hemsk bild som egentligen inte borde visas


Jackie, Sarah, Jag och Rosanna


Igen.

Puss!


lev livet fullt ut

Hello readers :') hah, idag har varit en underbar dag. Jag <3 vädret. Var i skolan, tråkigt som vanligt, matte nationella gick ju som det gick. HEJ IG!!!! När jag hade slutatt drog jag till Huddinge och mötte Niclas, Hampus och Josef sen mötte vi bea, hanna och nåååra till. Runt sex drog jag in till stan och mötte sarah, vi satte oss och käka. Sen träffade vi Jackie och väntade med henne inne på donken tills Rosanna kom, så snackade vi med dom. Skitsnällla & roliga! :D Sen drog vi tillbaka till trångsund och mötte Mathias, Simon och Danne ett tag. Bilderna får ni i nästa inlägg internet laggar sönder jao. Tjarå




Vi suger

Tjeeenare! Jag säger bara en sak, jag och sarah suger på orientering rent ut sagt. VG banan och hur det gick ska vi inte ens tala om. Hittade en kontroll :D Jaja ville bara uppdatera er lite nu ska vi göra lite andra saker, hörs sen babys! Puss ;)


Jag igår


Bloggtips från mig ;)



Dom flesta av er vet säkert redan vem hon är men till er som inte läser hennes blogg.... Hon kör verkligen sitt egna race och är hur grym och snygg som helst. Kolla in ;) Tjoffff

www.amiofsweden.myshowroom.se


Vad snygg man känner sig



Tjarå


oj..

Tja bitches! Är hemma hos Sarah nu och vi har legat och stekt med sololja och allting, så jävla vaaarmt! tror jag fått lite färg också ;) Hm.. nu ska vi käka lunch sen ska vi orientera på idrotten, den här gången kör vi VG banan eftersom att vi va så duktiga förra gången! Wish us luck ;) Hörs sen, pusspuss :D


Even the best one falls down sometimes ...

Nu hade jag och Sarah tänkt ta en liten promenad till vattnet och snacka om allting mellan himmel och jord, måste uttrycka känslor på henne och hon på mig. Så skönt att ha en bästavän man verkligen kan snacka med allt om!
Vi hörs senare.


3 år sen. Jag älskar dig mest av allt på hela jorden ♥


yeah

Har inte kunnat blogga någonting eftersom att blogg.se har cpat hela tiden och alla mina inlägg var borta.. fick typ panik!!!!!!! haha men nu är allt som vanligt igen - tack och lov.

Det har varit så jävla varmt idag som ni säkert vet, och jag hade jeans och värsta jackan på mig, duktigt Marilyn. Så efter skolan gick jag och Sarah hem till mig och bytte om, invigde shortsen idag hahaha :D skönt faaaktiskt. Sen drog vi en sväng till farsta sen förbi trångsund och mötte Mathias, Daniel och simon och fixade en sak.
 nu är vi hos sarah och funderar på att ta första doppet efter vi ätit....? återstår att se.  2 bilder från idag



HAHAHAH heeeeemsk

Ut i solen med er!!!

Nu ska vi ut i solen och hoppas på att bli lite brunare. 21 grader här ju :D sommaren är tillbax. pööösssssss

S&M! ;)


låten <3



sitter fortfarande hemma hos sarah och har inte fixat oss eller någonting, hur sega får man bli på en söndag på en skala 1 - 10 !? ganska sega. heeeeh. Som sagt söndag idag vilket betyder skola imorgon och jag har massa plugg idag, måste göra svenskan och musikläxan!!!! bajs :(


Bild från igår, ful.



knas

Hej broes. Kvällen igår kan jag ju inte säga världens roligaste menmen.. hände massa saker jag inte tänker ta upp här . Först drog vi ut och träffade Adam, Eddy, Marcus och hela raaasket. Sen drog jag och Sarah vidare till vh och mötte Simon och drog på någon fest, sen mötte vi Matilda och moa. sen åkte jag och Sarah till trångsund för att hämta mina nycklar, sen mötte vi chrille, ludde, viktor, felicia, linda, andrew, jonathan oooosv. Väldigt många namn igår kommer knappast ihåg haha :( här får ni lite bilder lixom. pussssssssssss





utgång

Outfit + facelook. Tjarå!




kortfattat

Har ingen ork att blogga längre.. typ. Det blir så ibland. Så ni vet. Igår var i alla fall jag och sarah i studion på dagen, ingen låt blev klar.... efter det åt vi på en skitgod resturang som typ är vår tradition, sen till medis, sen mötte vi Niclas och Ludwig ett tag. Och efter det drog vi till farsta och mötte upp andrew, carl, marcus, martin, adam, pontus osv osv. Var med dom, Vi gjorde lite saker.... hehehe. Nej men det var trevligt :) Sarah och jag somnade runt två, tidigt ju. Och nu sitter vi här fastklistrade framför datan. Haha ni ska bara se oss just nu!! Aja ska äta frukost sen fixa oss. Pusshej


Liten update

Hej :D Sitter nu i skolan och ska vara kvar här till typ halvsju för vi har någon himla ''trångsundsskolans kväll'' haha. Men det är lugnt för vi får ledigt hela dagen imorgon!?!? Värsta långa helgen. Hehe. Sen ska jag till Niclas sen tror jag jag ska sova hos Sarah :) Puss!


...

Den känslan när du kollar in i mina ögon går inte att beskriva..


tråkigt

Heeeej Sarah jag kopierar dina texter, haha tja. Det här var min gårdag!

Jag och Sarah drog till Ludde efter vi va på biblan, najs. Sen kom oxå Robin och va med oss, vi åt godis & kollade på Beck. Haha asså älska Beck<3 Ja, men sen så efter ett tag drog jag och Marilyn ner till kebabkungen (?) och mötte upp Rebecka, Kevin, Niclas & liilla Elias, skitsöt unge! Ja, men sen lämna Kevin Elias till hans mami typ och sen drog Rebecka, sen så gjorde vi inte mycket, jag och Marilyn fick våra skrattattacker som vanligt, dom käkade, sen satte vi oss på donken och värmde oss i väntan på våran buss så kom några & sådära..

update: mitt internet funkar fortfarande inte, det suger. Har no nu, senare ska jag till stan, just saying.. tjarååå.


wiho

Fan vad jag och Sarah är duktiga på att orientera, (måste få skryta lite!!) Vi fick 9 av 10 rätt. Vilket vi aldrig fått på orientering förut, det gick fett bra och var inte SÅ hemskt som jag trodde :) Nu har vi lagat mat och fixat oss och ska snart ta bussen till Trångsund centrum och låna en bok... hahaha, måste ha till redovisningen imorgon. Vi hörs!


Read it

Både ni Emelie och Sarah som vill ha min rutiga tjocktröja och erbjuder 150 båda två, då får den som erbjuder högre än den andra tröjan! :) bara att kommentera eller maila mig. Puss


Lets go!


HAHAHAHAHAHAHAHHAHAHAHA! jag ser ut som en luffare


suuuug

Heeej sötnosar! Förlåt att jag inte bloggade igår eller någonting men igår när jag kom hem funkade inte mitt internet, fick verkligen panik.. sen imorse inte heller!!! så vet inte om det funkar ikväll heller, cp :(

Det gick väl iaf bra att sjunga igår tror jag.. hehe. Och nu är jag hemma hos Sarah för vi ska ha orientering om typ en halvtimme på idrotten och hon bor nära så aa :) Vi hörs sen, hoppas vi♥

Lite bilder från igår.



update

Är i studion nu. Ska snart sjunga på scenen framför typ kanske 60 pers? (ja, mycket för mig) Nervöst ju... bloggar mer när jag kommer hem. Puss♥

Såhär ser jag ut idag

Hinner inte ta bättre bild, nu ska jag till skolan.. Puss!

2 maj

Godmorgon sötisar! Försov mig på So lektionen så är fortfarande hemma.. och börjar 11 med engelska! Så ska bara ha en lugn morgon och äta frukost strax :) Idag efter skolan är det en spännande dag, då ska jag och sarah till studion och sjunga upp oss lite eller vad man säger, sen ska vi sjunga live.. iiih ! Mer om det sen :) Slänger kanske in dagens outfit innan jag drar om jag hinner annars får ni den ikväll! pussi


goodnight sleep tight

Kom hem för ett tag sen. Sarah kom förbi mig en sväng runt sex sen drog hon hem och jag vidare till Huddinge och mötte Beatrice, Hampus och Niclas. Vi köpte godis sen drog vi hem till Niclas och kollade på film! Mysigt :) och nu är jag som sagt hemma och ska lägga mig och sova. Vi hörs imorgon! Tre bilder från ikväll, puss




Skjorta kavaj och röda byxor

Är hemma helt själv & några timmar till, helt underbart skönt! Lyssnar på lite musik och ska snart göra musikläxan. Men innan dess hade jag kanske tänkt fixa till mig lite och ta lite nya bilder till en ny header och en ny profilbild på facebook kanske? Haha snacka om att roa sig själv ;)

Såhär söt är jag just nu


Mini bloppis!

Skitmysig tjocktröja! 100 :- storlek S fast är som en XS!

Cool t- shirt med tryck! 50 :- storlek XS

Grå kofta 100 :- storlek XS

Tubkjol 50 :- XS

Vita jeans med hål i 100 :- storlek 32. Sitter taaaajt.. ska säljas

 

Bara att skriva i kommentarsfältet eller skicka ett mail till marilynsandberg@hotmail.com så kan vi snacka mer om vart vi ska mötas osv! Puss


Valborg

Hello! Kvällen igår var najs. Först drog jag och Sarah till stortorpsparken där det var majbrasa så träffa man typ 92180281092 personer som vi var med. Sen drog vi till huddinge hem till oliver ett tag där beatrice, hanna och alla andra var. Sen drog vi vidare till trångsund till Simon. Hehe what happends in Trångsund stays in Trångsund, just saying ;) Och idag vaknade vi upp hemma hos Sarah runt klockan tio och drog direkt in till farsta centrum och käkade på donken, har aldrig vart så hungrig eller törstig i mitt liv typ, hemskt. Och nu är jag hemma. Helt död, ska plugga lite och hade tänkt försöka blogga mer idag. Bra va? :D 

Hade inte kameran uppe så mycket under kvällen, tyvärr..


RSS 2.0